lysogeny broth lb medium (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
lysogeny broth lb medium
Lysogeny Broth Lb Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lb+broth+medium/Ampicillin/pm42337800-79-20-27
Average 99 stars, based on 1 article reviews
Lysogeny Broth Lb Medium, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lb+broth+medium/Ampicillin/pm42337800-79-20-27
Average 99 stars, based on 1 article reviews
lysogeny broth lb medium - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Bacteria:Article Title: Action of 3-Hydroxy-3-Methylglutaryl-CoA Reductase Inhibitors on ABCA-1 protein (ATP-Binding Cassette Transporter-1) in endothelial cells stimulated with uremic serum. Article Snippet: The bacteria were then plated on LB Agar medium (Luria Bertani) (Sigma-Aldrich, USA) supplemented with 100 μg/mL ampicillin (Gibco, USA) and incubated for 24 h at 37oC with 5% CO2 saturation. .. After colony growth, bacteria were cultured in Article Title: Interfacial water confers transcription factors with dinucleotide specificity. Article Snippet: The pETG20A_SPB vectors with BARHL2 and its mutant sequences (GenScript) were expressed in Rosetta(DE3)pLysS E. coli strain (Millipore). .. In brief, the bacteria were grown overnight at 37 °C in Article Title: Oligonucleotide agonists targeting progranulin Article Snippet: GRN 5′ UTR Luciferase Reporter Constructs The GRN 5′ UTR sequence (SEQ ID #690) was cloned into the psiCHECK2 plasmid (Promega) immediately in front of the renilla luciferase ATG site using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer's instruction. .. 5′ UTR sequence from nucleotide number 38 to 256 according to Homo sapiens granulin precursor (GRN), RefSeq NM_002087.3 (SEQ ID NO 1): SEQ 690 ID#GGCGAGAGGAAGCAGGGAGGAGAGTGATTTGAGTAGAAAAGAAACAC AGCATTCCAGGCTGGCCCCACCTCTATATTGATAAGTAGCCAATGGGAGC GGGTAGCCCTGATCCCTGGCCAATGGAAACTGAGGTAGGCGGGTCATCGC GCTGGGGTCTGTAGTCTGAGCGCTACCCGGTTGCTGCTGCCCAAGGACCG CGGAGTCGGACGCAGGCAGACC For the site-directed mutagenesis and insertion of the GRN 5′ UTR the following primers were used: Forward primer SEQ ID NO 691 5′-ATGGAAACTGAGGTAGGCGGGTCATCGCGCTGGGGTCTGTAGTCTGA GCGCTACCCGGTTGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAG ACCATGGCTTCCAAGGTGTACGACCCCGAGC-3′ and reverse primer SEQ ID NO 692 5′-TGGCCAGGGATCAGGGCTACCCGCTCCCATTGGCTACTTATCAATAT AGAGGTGGGGCCAGCCTGGAATGCTGTGTTTCTTTTCTACTCAAATCACT CTCCTCCCTGCTTCCTCTCGCCGGCTAGCCTATAGTGAGTCGTATTAAGT AC After transformation of chemical competent bacteria (One Shot TOP10 Chemically Competent E. coli, Thermofisher) and overnight growth on LB agar plates containing ampicillin (imMedia Growth Medium, agar, ampicillin, Thermofisher), single colonies were selected and further grown overnight with constant shaking at 37 Degrees Celcius in Article Title: Oligonucleotide agonists targeting progranulin Article Snippet: SEQ ID#2: GGGACAGTACTGAAGACTCTGCAGCCCTCGGGACCCCACTCGGAGGGTGC CCTCTGCTCAGGCCTCCCTAGACCTCCCCCTAACCAAATTCTCCCTGGAC CCCATTCTGAGCTCCCCATCACCATGGGAGGTGGGGCCTCAATCTAAGGC CTTCCCTGTCAGAAGGGGGTTGTGGCAAAAGCCACATTACAAGCTGCCAT CCCCTCCCCGTTTCAGTGGACCCTGTGGCCAGGTGCTTTTCCCTATCCAC AGGGGTGTTTGTGTGTGTGCGCGTGTGCGTTTCAATAAAGTTTGTACACT TTCTTAA Double stranded DNA fragment (gBlock, Integrated DNA technologies) containing the GRN 3′ UTR (SEQ ID #2) flanked by XhoI and NotI sites was cut by XhoI and NotI enzymes (New England Biolabs) according to vendors protocol and ligated using T4 Ligase (New England Biolabs) into the previously XhoI/NotI cut psiCHECK2 plasmid. .. After transformation of chemical competent bacteria (One Shot® TOP10 Chemically Competent E. coli, Thermofisher) and overnight growth on LB agar plates containing ampicillin (imMedia Growth Medium, agar, ampicillin, Thermofisher), single colonies were selected and further grown overnight with constant shaking at 37 Degrees Celcius in Cell Culture:Article Title: Action of 3-Hydroxy-3-Methylglutaryl-CoA Reductase Inhibitors on ABCA-1 protein (ATP-Binding Cassette Transporter-1) in endothelial cells stimulated with uremic serum. Article Snippet: The bacteria were then plated on LB Agar medium (Luria Bertani) (Sigma-Aldrich, USA) supplemented with 100 μg/mL ampicillin (Gibco, USA) and incubated for 24 h at 37oC with 5% CO2 saturation. .. After colony growth, bacteria were cultured in Incubation:Article Title: Action of 3-Hydroxy-3-Methylglutaryl-CoA Reductase Inhibitors on ABCA-1 protein (ATP-Binding Cassette Transporter-1) in endothelial cells stimulated with uremic serum. Article Snippet: The bacteria were then plated on LB Agar medium (Luria Bertani) (Sigma-Aldrich, USA) supplemented with 100 μg/mL ampicillin (Gibco, USA) and incubated for 24 h at 37oC with 5% CO2 saturation. .. After colony growth, bacteria were cultured in Article Title: Significance of zinc-solubilizing plant growth-promoting rhizobacterial strains in nutrient acquisition, enhancement of growth, yield, and oil content of canola ( Brassica napus L.) Article Snippet: .. Each strain cultures were incubated in 5 ml of Plasmid Preparation:Article Title: Action of 3-Hydroxy-3-Methylglutaryl-CoA Reductase Inhibitors on ABCA-1 protein (ATP-Binding Cassette Transporter-1) in endothelial cells stimulated with uremic serum. Article Snippet: The bacteria were then plated on LB Agar medium (Luria Bertani) (Sigma-Aldrich, USA) supplemented with 100 μg/mL ampicillin (Gibco, USA) and incubated for 24 h at 37oC with 5% CO2 saturation. .. After colony growth, bacteria were cultured in Purification:Article Title: Action of 3-Hydroxy-3-Methylglutaryl-CoA Reductase Inhibitors on ABCA-1 protein (ATP-Binding Cassette Transporter-1) in endothelial cells stimulated with uremic serum. Article Snippet: The bacteria were then plated on LB Agar medium (Luria Bertani) (Sigma-Aldrich, USA) supplemented with 100 μg/mL ampicillin (Gibco, USA) and incubated for 24 h at 37oC with 5% CO2 saturation. .. After colony growth, bacteria were cultured in Article Title: Completely noninvasive multi-analyte monitoring system for cell culture processes Article Snippet: .. The Control:Article Title: Biological amelioration of water stress in rapeseed ( Brassica napus L.) by exopolysaccharides‐producing Pseudomonas protegens ML15 Article Snippet: .. An overnight liquid culture of each isolate (2%, v/v) was inoculated into Article Title: Biological amelioration of water stress in rapeseed (Brassica napus L.) by exopolysaccharides-producing Pseudomonas protegens ML15. Article Snippet: .. An overnight liquid culture of each isolate (2%, v/v) was inoculated into Sequencing:Article Title: Oligonucleotide agonists targeting progranulin Article Snippet: GRN 5′ UTR Luciferase Reporter Constructs The GRN 5′ UTR sequence (SEQ ID #690) was cloned into the psiCHECK2 plasmid (Promega) immediately in front of the renilla luciferase ATG site using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer's instruction. .. 5′ UTR sequence from nucleotide number 38 to 256 according to Homo sapiens granulin precursor (GRN), RefSeq NM_002087.3 (SEQ ID NO 1): SEQ 690 ID#GGCGAGAGGAAGCAGGGAGGAGAGTGATTTGAGTAGAAAAGAAACAC AGCATTCCAGGCTGGCCCCACCTCTATATTGATAAGTAGCCAATGGGAGC GGGTAGCCCTGATCCCTGGCCAATGGAAACTGAGGTAGGCGGGTCATCGC GCTGGGGTCTGTAGTCTGAGCGCTACCCGGTTGCTGCTGCCCAAGGACCG CGGAGTCGGACGCAGGCAGACC For the site-directed mutagenesis and insertion of the GRN 5′ UTR the following primers were used: Forward primer SEQ ID NO 691 5′-ATGGAAACTGAGGTAGGCGGGTCATCGCGCTGGGGTCTGTAGTCTGA GCGCTACCCGGTTGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAG ACCATGGCTTCCAAGGTGTACGACCCCGAGC-3′ and reverse primer SEQ ID NO 692 5′-TGGCCAGGGATCAGGGCTACCCGCTCCCATTGGCTACTTATCAATAT AGAGGTGGGGCCAGCCTGGAATGCTGTGTTTCTTTTCTACTCAAATCACT CTCCTCCCTGCTTCCTCTCGCCGGCTAGCCTATAGTGAGTCGTATTAAGT AC After transformation of chemical competent bacteria (One Shot TOP10 Chemically Competent E. coli, Thermofisher) and overnight growth on LB agar plates containing ampicillin (imMedia Growth Medium, agar, ampicillin, Thermofisher), single colonies were selected and further grown overnight with constant shaking at 37 Degrees Celcius in Mutagenesis:Article Title: Oligonucleotide agonists targeting progranulin Article Snippet: GRN 5′ UTR Luciferase Reporter Constructs The GRN 5′ UTR sequence (SEQ ID #690) was cloned into the psiCHECK2 plasmid (Promega) immediately in front of the renilla luciferase ATG site using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer's instruction. .. 5′ UTR sequence from nucleotide number 38 to 256 according to Homo sapiens granulin precursor (GRN), RefSeq NM_002087.3 (SEQ ID NO 1): SEQ 690 ID#GGCGAGAGGAAGCAGGGAGGAGAGTGATTTGAGTAGAAAAGAAACAC AGCATTCCAGGCTGGCCCCACCTCTATATTGATAAGTAGCCAATGGGAGC GGGTAGCCCTGATCCCTGGCCAATGGAAACTGAGGTAGGCGGGTCATCGC GCTGGGGTCTGTAGTCTGAGCGCTACCCGGTTGCTGCTGCCCAAGGACCG CGGAGTCGGACGCAGGCAGACC For the site-directed mutagenesis and insertion of the GRN 5′ UTR the following primers were used: Forward primer SEQ ID NO 691 5′-ATGGAAACTGAGGTAGGCGGGTCATCGCGCTGGGGTCTGTAGTCTGA GCGCTACCCGGTTGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAG ACCATGGCTTCCAAGGTGTACGACCCCGAGC-3′ and reverse primer SEQ ID NO 692 5′-TGGCCAGGGATCAGGGCTACCCGCTCCCATTGGCTACTTATCAATAT AGAGGTGGGGCCAGCCTGGAATGCTGTGTTTCTTTTCTACTCAAATCACT CTCCTCCCTGCTTCCTCTCGCCGGCTAGCCTATAGTGAGTCGTATTAAGT AC After transformation of chemical competent bacteria (One Shot TOP10 Chemically Competent E. coli, Thermofisher) and overnight growth on LB agar plates containing ampicillin (imMedia Growth Medium, agar, ampicillin, Thermofisher), single colonies were selected and further grown overnight with constant shaking at 37 Degrees Celcius in Transformation Assay:Article Title: Oligonucleotide agonists targeting progranulin Article Snippet: GRN 5′ UTR Luciferase Reporter Constructs The GRN 5′ UTR sequence (SEQ ID #690) was cloned into the psiCHECK2 plasmid (Promega) immediately in front of the renilla luciferase ATG site using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer's instruction. .. 5′ UTR sequence from nucleotide number 38 to 256 according to Homo sapiens granulin precursor (GRN), RefSeq NM_002087.3 (SEQ ID NO 1): SEQ 690 ID#GGCGAGAGGAAGCAGGGAGGAGAGTGATTTGAGTAGAAAAGAAACAC AGCATTCCAGGCTGGCCCCACCTCTATATTGATAAGTAGCCAATGGGAGC GGGTAGCCCTGATCCCTGGCCAATGGAAACTGAGGTAGGCGGGTCATCGC GCTGGGGTCTGTAGTCTGAGCGCTACCCGGTTGCTGCTGCCCAAGGACCG CGGAGTCGGACGCAGGCAGACC For the site-directed mutagenesis and insertion of the GRN 5′ UTR the following primers were used: Forward primer SEQ ID NO 691 5′-ATGGAAACTGAGGTAGGCGGGTCATCGCGCTGGGGTCTGTAGTCTGA GCGCTACCCGGTTGCTGCTGCCCAAGGACCGCGGAGTCGGACGCAGGCAG ACCATGGCTTCCAAGGTGTACGACCCCGAGC-3′ and reverse primer SEQ ID NO 692 5′-TGGCCAGGGATCAGGGCTACCCGCTCCCATTGGCTACTTATCAATAT AGAGGTGGGGCCAGCCTGGAATGCTGTGTTTCTTTTCTACTCAAATCACT CTCCTCCCTGCTTCCTCTCGCCGGCTAGCCTATAGTGAGTCGTATTAAGT AC After transformation of chemical competent bacteria (One Shot TOP10 Chemically Competent E. coli, Thermofisher) and overnight growth on LB agar plates containing ampicillin (imMedia Growth Medium, agar, ampicillin, Thermofisher), single colonies were selected and further grown overnight with constant shaking at 37 Degrees Celcius in Article Title: Oligonucleotide agonists targeting progranulin Article Snippet: SEQ ID#2: GGGACAGTACTGAAGACTCTGCAGCCCTCGGGACCCCACTCGGAGGGTGC CCTCTGCTCAGGCCTCCCTAGACCTCCCCCTAACCAAATTCTCCCTGGAC CCCATTCTGAGCTCCCCATCACCATGGGAGGTGGGGCCTCAATCTAAGGC CTTCCCTGTCAGAAGGGGGTTGTGGCAAAAGCCACATTACAAGCTGCCAT CCCCTCCCCGTTTCAGTGGACCCTGTGGCCAGGTGCTTTTCCCTATCCAC AGGGGTGTTTGTGTGTGTGCGCGTGTGCGTTTCAATAAAGTTTGTACACT TTCTTAA Double stranded DNA fragment (gBlock, Integrated DNA technologies) containing the GRN 3′ UTR (SEQ ID #2) flanked by XhoI and NotI sites was cut by XhoI and NotI enzymes (New England Biolabs) according to vendors protocol and ligated using T4 Ligase (New England Biolabs) into the previously XhoI/NotI cut psiCHECK2 plasmid. .. After transformation of chemical competent bacteria (One Shot® TOP10 Chemically Competent E. coli, Thermofisher) and overnight growth on LB agar plates containing ampicillin (imMedia Growth Medium, agar, ampicillin, Thermofisher), single colonies were selected and further grown overnight with constant shaking at 37 Degrees Celcius in |